Learn the Language of Modern Biology

Master

by Coding Algorithms.

Sharpen your skills with 50+ bioinformatics coding problems, with Python,
Bash and R tracks on the way. Learn the fundamentals,
build real skills, and go beyond the textbook.

Start Solving Problems Create Free Account
0+ Benchmark Problems
Python 3 & R 4.0
Real-time Code Execution
dna_nucleotides.py
Python 3 Run
# Counting DNA Nucleotides
def count_nucleotides(dna_string):
return {
'A': dna_string.count('A'),
'C': dna_string.count('C'),
'G': dna_string.count('G'),
'T': dna_string.count('T')
}
# Sample Input: AGCTTTTCATTCTGACTGCA
print(count_nucleotides("AGCTTTTCATTCTGACTGCA"))
✔ Verdict: Accepted (Output: {'A': 5, 'C': 4, 'G': 4, 'T': 7})

Instant In-Browser Execution

Write Python or R solutions directly in the Monaco editor and execute them synchronously against real judge execution backends.

Multi-Tier Problem Bank

Progress through 20 curated problems spanning Foundational (nucleotide counts), Intermediate (k-mers, RNA splicing), and Advanced (affine gap alignment, Viterbi HMMs).

Multi-Test Case Evaluation

Every submission is automatically validated against a battery of hidden test cases including edge cases, homopolymers, and length constraints.

Explore by Domain

Pick a domain to see real problems from the bank.

From the Central Dogma to CtrlDogma

In molecular biology, the central dogma describes the flow of genetic information: DNA → RNA → Protein. It is the fundamental principle that governs how life stores, transmits, and expresses its code.

CtrlDogma lets you control that flow — digitally. Instead of only reading about transcription, translation, and sequence analysis, you practice the bioinformatics algorithms behind them: counting nucleotides, transcribing DNA to RNA, computing reverse complements, finding motifs, aligning sequences, and modelling with hidden Markov models — all in a browser-based Python & R IDE.

CtrlDogma is The Platform to Practice Bioinformatics Algorithms, Computational Biology, and Biological Data Science. Here you build fundamental concepts from the ground up, turn them into real projects, and grow a track record — solved-problem scores and a shareable public profile — that strengthens your résumé and helps you reach higher positions and land better opportunities in bioinformatics and computational biology.

Start Practicing Create a Free Account
Francis Crick's 1958 Central Dogma Diagram
Image credit: Crick's 1958 Central Dogma (Public Domain via Wikimedia Commons)